IB DP Biology- D1.3 Mutations and gene editing- IB Style Questions For HL Paper 1A -New Syllabus
Question
Two DNA sequences are shown.
| Sequence 1 | CACGTGGACTGAGGACTCCTC |
| Sequence 2 | CACGTGGACTGAGGACACCTC |
What type of mutation is occurring between sequence 1 and sequence 2?
(B) Polyploidy
(C) Insertion
(D) Deletion
▶️ Answer/Explanation
Correct Answer: \( \boxed{\mathbf{A}} \)
The two DNA sequences differ by only one nucleotide, where T in Sequence 1 is replaced by A in Sequence 2. Since no nucleotides are added or removed, this change is a substitution mutation.
Question
A DNA sequence before and after a mutation is shown.
Before mutation 3′ TAC TCC TGC TTC 5′
After mutation 3′ TAC TGC TGC TTC 5′
The table contains mRNA codons and their associated amino acids.
| mRNA codon | Amino acid |
|---|---|
| AUG | Met |
| AGG | Arg |
| ACG | Thr |
| AAG | Lys |
| UAC | Tyr |
| UCC | Ser |
| UGC | Cys |
| UUC | Phe |
What would be the effect of this mutation on the translated polypeptide?
(A) Thr would replace Arg.
(B) Cys would replace Ser.
(C) There would be an extra Arg.
(D) There would be no change in the amino acid sequence.
▶️ Answer/Explanation
After mutation, the sequence becomes 3′–TAC TGC TGC TTC–5′, giving mRNA 5′–AUG ACG ACG AAG–3′, coding for Met–Thr–Thr–Lys.
Thus, Thr replaces Arg due to the base substitution changing the codon AGG to ACG.
✅ Answer: (A)
Question
What is the main purpose of performing a gene knockout?
B. Studying a gene’s role by disabling it so it cannot function
C. Detecting a gene by modifying it to create a different protein
D. Altering a gene in order to trigger programmed cell death
▶️ Answer/Explanation
✅ Answer: (B)
