Home / IB DP Biology- D1.3 Mutations and gene editing- IB Style Questions For HL Paper 1A

IB DP Biology- D1.3 Mutations and gene editing- IB Style Questions For HL Paper 1A -New Syllabus

Question

Two DNA sequences are shown.

Sequence 1CACGTGGACTGAGGACTCCTC
Sequence 2CACGTGGACTGAGGACACCTC

What type of mutation is occurring between sequence 1 and sequence 2?

(A) Substitution
(B) Polyploidy
(C) Insertion
(D) Deletion
▶️ Answer/Explanation

Correct Answer: \( \boxed{\mathbf{A}} \)

The two DNA sequences differ by only one nucleotide, where T in Sequence 1 is replaced by A in Sequence 2. Since no nucleotides are added or removed, this change is a substitution mutation.

Question

A DNA sequence before and after a mutation is shown.

Before mutation  3′ TAC TCC TGC TTC 5′
After mutation  3′ TAC TGC TGC TTC 5′

The table contains mRNA codons and their associated amino acids.

mRNA codonAmino acid
AUGMet
AGGArg
ACGThr
AAGLys
UACTyr
UCCSer
UGCCys
UUCPhe

What would be the effect of this mutation on the translated polypeptide?

(A) Thr would replace Arg.
(B) Cys would replace Ser.
(C) There would be an extra Arg.
(D) There would be no change in the amino acid sequence.

▶️ Answer/Explanation
Before mutation, the mRNA transcribed from the DNA sequence 3′–TAC TCC TGC TTC–5′ would be 5′–AUG AGG ACG AAG–3′, coding for Met–Arg–Thr–Lys.
After mutation, the sequence becomes 3′–TAC TGC TGC TTC–5′, giving mRNA 5′–AUG ACG ACG AAG–3′, coding for Met–Thr–Thr–Lys.
Thus, Thr replaces Arg due to the base substitution changing the codon AGG to ACG.
Answer: (A)

Question

What is the main purpose of performing a gene knockout?

A.  Increasing protein output by altering a gene
B.  Studying a gene’s role by disabling it so it cannot function
C.  Detecting a gene by modifying it to create a different protein
D.  Altering a gene in order to trigger programmed cell death
▶️ Answer/Explanation
A gene knockout involves intentionally inactivating a gene to observe what changes occur in the organism. This helps reveal the gene’s normal function by seeing what happens when it is absent.
Answer: (B)
Scroll to Top